View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17751_low_8 (Length: 381)
Name: NF17751_low_8
Description: NF17751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17751_low_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 192 - 379
Target Start/End: Complemental strand, 37004276 - 37004089
Alignment:
| Q |
192 |
ataatattaaactcaataattattattaacgtaacacaaaataaaactcaacatgataaataatgctagaccnnnnnnngtacaataaataatgatatgc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37004276 |
ataatattaaactcaataattattattaacgtaacacaaaataaaactcaacatgataaataatgctagaccaaaaaaagtacaataaataatgatatgt |
37004177 |
T |
 |
| Q |
292 |
ccttgtttatagcggcgtctagtgtaagttgtcactatatctggtcctacggttaaattttgagcaatgttatttgaacaactcttta |
379 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
37004176 |
ccttgtttatagcggcgtctggtgtaagttgtcactatatccggtcctacagttaaattttgagcaatgttctttgaacaacccttta |
37004089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 19 - 127
Target Start/End: Complemental strand, 37004449 - 37004341
Alignment:
| Q |
19 |
ataccaaagtcgagagatttcaaataatacgggacaaacacaccactataatctaggctggctaaatgcaagccaacaatgggatattttgcttgtttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37004449 |
ataccaaagtcgagagatttcaaataatacgggacaaacacaccactataatctaggcaggctaaatgcaagccaacaatgggatattttgcttgtttgt |
37004350 |
T |
 |
| Q |
119 |
ggccatcac |
127 |
Q |
| |
|
||||||||| |
|
|
| T |
37004349 |
ggccatcac |
37004341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 351 - 381
Target Start/End: Complemental strand, 42652779 - 42652749
Alignment:
| Q |
351 |
ttgagcaatgttatttgaacaactctttatt |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42652779 |
ttgagcaatgttatttgaacaactctttatt |
42652749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University