View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17752_high_15 (Length: 394)
Name: NF17752_high_15
Description: NF17752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17752_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 5e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 13 - 127
Target Start/End: Complemental strand, 21075550 - 21075430
Alignment:
| Q |
13 |
aacctgtgttgtcgtattgaattcttatgacactcgaa-tggactcggccttctgtcatatgccactattatcttaaatcttctaac-----aaacattc |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
21075550 |
aacctctgttgtcgtattgaattcttatgacactcgaaatggactcggccttctgtcatatgccactattatcttaaatcttcgaacaaattaaacattc |
21075451 |
T |
|
| Q |
107 |
aagagatatataaagtgaacc |
127 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
21075450 |
aagagatatatagagtgaacc |
21075430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 232 - 364
Target Start/End: Complemental strand, 21075132 - 21074999
Alignment:
| Q |
232 |
atgactacactcggttaccttgctatcgatgattcaaagcataattctattacttcgtccaagatcctagcatttatactatcacttaactacatattga |
331 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||| ||||||||||||||||||| || | ||||||||||| ||||||||||||| |||| ||| ||| |
|
|
| T |
21075132 |
atgactacacatggttaccttgttatcaatgattcctagcataattctattacttcatcgatgatcctagcatgtatactatcactttactatatagtga |
21075033 |
T |
|
| Q |
332 |
atgaattttta-aattttcaattgtagttcagac |
364 |
Q |
| |
|
| ||||||||| || |||| |||||||||||||| |
|
|
| T |
21075032 |
aggaatttttataactttcgattgtagttcagac |
21074999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University