View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17752_low_34 (Length: 274)
Name: NF17752_low_34
Description: NF17752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17752_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 181
Target Start/End: Original strand, 30715975 - 30716138
Alignment:
| Q |
18 |
atcaaaggggtatttgtgaatggattgagggaagagtttcatgattgggttctcatgcagaaacccacatctttgaacgatgcattgagattggcatttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30715975 |
atcaaaggggtatttgtgaatggattgagggaagagtttcatgattgggttctcatgcagaaacccacatctttgaacgatgcattgagattgacatttg |
30716074 |
T |
|
| Q |
118 |
attttgagcatgtgagaaggattagttgaaagaaggaaattgtttctacttgtgggttttgtga |
181 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30716075 |
attttgagtatgtgagaaggattagtggaaagaaggaaattgtttctacttgtgggttttgtga |
30716138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 176 - 260
Target Start/End: Original strand, 30716160 - 30716244
Alignment:
| Q |
176 |
ttgtgaagttagggaagagatgagagaactatggagacaaagtgggaagaaagtgggaagtgataaggttgctaaagatcttttt |
260 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
30716160 |
ttgtggagttagggaagagacgagagaactatggagacaaagtgggaagaaagagggaagtgataaggttgccaaagatcttttt |
30716244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University