View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17753_low_8 (Length: 283)
Name: NF17753_low_8
Description: NF17753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17753_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 267
Target Start/End: Complemental strand, 34391332 - 34391078
Alignment:
| Q |
13 |
aaaatatgagttatccaaaggagatttagttgtttgtccagaaggaacaacatgtcgcgagcctttccttttacgatttagtgctctatttgccgagcta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34391332 |
aaaatatgagttatccaaaggagatttagttgtctgtccagaaggaacaacatgtcgcgagcctttccttttacgatttagtgctctatttgccgagcta |
34391233 |
T |
|
| Q |
113 |
actgaccggatagtaccggtcgccatgaactatagagtagggttcttccatgcaacaactgcaaggggatggaagggtttggacccggttttcttcttca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
34391232 |
actgaccggatagtaccggtcgccatgaactatagagtagggttcttccatgcaaccactgcaaggggttggaaaggtttggacccggttttcttcttca |
34391133 |
T |
|
| Q |
213 |
tgaacccaagaccagtttatgaggttactttcttgaaccagttgccggttgaagc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34391132 |
tgaacccaagaccagtttatgaggttacattcttgaaccagttgccggttgaagc |
34391078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 67
Target Start/End: Complemental strand, 39975889 - 39975852
Alignment:
| Q |
30 |
aaggagatttagttgtttgtccagaaggaacaacatgt |
67 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
39975889 |
aaggtgatttagttgtttgtcctgaaggaacaacatgt |
39975852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University