View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17754_high_16 (Length: 295)
Name: NF17754_high_16
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17754_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 287
Target Start/End: Original strand, 46958232 - 46958500
Alignment:
| Q |
19 |
atcccggtaaagtataaagatgatgtttttatgggaatgggaatttgttgcagaagagtgcattaaagtggggtatggtatggggaagaagaaataaagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46958232 |
atcccggtaaagtataaagatgatgtttttatgggaatgggaatttattgcagaagagtgcattaaagtggggtatggtatggggaagaagaaataaagt |
46958331 |
T |
 |
| Q |
119 |
gcatgtttttagttctagttcaagaaggttgatttattgagaatttagttaagaatggtaaatctttaaatattttgatataatggttttaccaataaga |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46958332 |
gcatgtttttagttctagctcaagaaggttgatttattgagaatttagttaagaatggtaaatctttaaatattttgatataatggttttaccaataaga |
46958431 |
T |
 |
| Q |
219 |
tggtacttattacttgataataggtagttttccatttacatcggaatattttgttaaattgcatggtct |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46958432 |
tggtacttattacttgataataggtagttttccatttacatcggaattttttgttaaattgcatggtct |
46958500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University