View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17754_high_19 (Length: 282)
Name: NF17754_high_19
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17754_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 144 - 274
Target Start/End: Original strand, 7150787 - 7150917
Alignment:
| Q |
144 |
tttgtttgttcctctgcttagttttgtgtccgcatgggagagtgacacatatttacgactctttatcagatttgggtttgaactcggatctataactttt |
243 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7150787 |
tttgtttgtttctctgcttggttttgtatccgcatgggagagtgacacatatttacgactctttatcagatttgggtttgaactcagatctataactttt |
7150886 |
T |
|
| Q |
244 |
taggttttagtttggttttggtgatgatgtc |
274 |
Q |
| |
|
||||||||| |||||||||||| |||||||| |
|
|
| T |
7150887 |
taggttttaatttggttttggttatgatgtc |
7150917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 54
Target Start/End: Original strand, 7150659 - 7150694
Alignment:
| Q |
19 |
ctttttgtgggtgttttggttgtctgcactgaagag |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150659 |
ctttttgtgggtgttttggttgtctgcactgaagag |
7150694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University