View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17754_high_27 (Length: 244)

Name: NF17754_high_27
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17754_high_27
NF17754_high_27
[»] chr3 (3 HSPs)
chr3 (76-116)||(25636448-25636488)
chr3 (194-227)||(25616559-25616592)
chr3 (198-227)||(25628132-25628161)


Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 116
Target Start/End: Original strand, 25636448 - 25636488
Alignment:
76 tgacaatcaaatcactgttgcttttagtcatattctagaac 116  Q
    |||||||||||||||||||||||||||||||||||||||||    
25636448 tgacaatcaaatcactgttgcttttagtcatattctagaac 25636488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 194 - 227
Target Start/End: Original strand, 25616559 - 25616592
Alignment:
194 tgctccttaaactcacaccctcgctctccatctt 227  Q
    ||||||||||||||||||||||||||||||||||    
25616559 tgctccttaaactcacaccctcgctctccatctt 25616592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 227
Target Start/End: Original strand, 25628132 - 25628161
Alignment:
198 ccttaaactcacaccctcgctctccatctt 227  Q
    ||||||||||||||||||||||||||||||    
25628132 ccttaaactcacaccctcgctctccatctt 25628161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University