View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17754_low_20 (Length: 293)
Name: NF17754_low_20
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17754_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 13 - 277
Target Start/End: Original strand, 55076608 - 55076872
Alignment:
| Q |
13 |
aatatgcttcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatgg |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076608 |
aatatgcttcaaggaccctgtcgtgccttccttggtgaccttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatgg |
55076707 |
T |
|
| Q |
113 |
ccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076708 |
ccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaa |
55076807 |
T |
|
| Q |
213 |
tctcaaaacatgtttcttcttatcaatattccttctcgctctcgtttcttcctttgctctatatt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076808 |
tctcaaaacatgtttcttcttatcaatattccttctcgctctcgtttcttcctttgctctatatt |
55076872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 13 - 146
Target Start/End: Complemental strand, 15125445 - 15125312
Alignment:
| Q |
13 |
aatatgcttcaaggaccatgtcgtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatgg |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |||| ||||||||||||||||||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
15125445 |
aatatgcttcaaggaccttgtcgtgccttcattggtgacctcgctggtggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatgg |
15125346 |
T |
|
| Q |
113 |
ccgtgggaaatatccttggttatgccgccggctc |
146 |
Q |
| |
|
|||| || ||| ||||||||||||| || ||||| |
|
|
| T |
15125345 |
ccgtcggtaatgtccttggttatgctgctggctc |
15125312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 191
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
| Q |
109 |
atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc |
191 |
Q |
| |
|
|||||||| || || ||||| ||||| |||||||| ||| ||||||||||| |||| ||||||| |||||| |||| ||||| |
|
|
| T |
43665688 |
atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc |
43665606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University