View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17754_low_25 (Length: 263)
Name: NF17754_low_25
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17754_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 143 - 238
Target Start/End: Complemental strand, 36168495 - 36168400
Alignment:
| Q |
143 |
gttgacaaaacatcatatgcatcatgtaatggtgactgtatacatacacgacgggacagaactcttggcagttgcttcagttagtcaatcacaata |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36168495 |
gttgacaaaacatcatatgcatcatgtaatgctgactgtatacatacacgacgggacagaactcttggcagttgcttcagttagtgaatcacaata |
36168400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 36168636 - 36168552
Alignment:
| Q |
13 |
aatattaatgcgattttgtatatctcttcaatgagcatgatatgcatttcaccaataaataaacaacaacatgatatattatatt |
97 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36168636 |
aatattaatgcgattttgtatatctcgtcaacgagcatgatatgcatttcaccaataattaaacaacaacatgatatattatatt |
36168552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University