View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17754_low_28 (Length: 253)
Name: NF17754_low_28
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17754_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 14 - 253
Target Start/End: Complemental strand, 14518491 - 14518256
Alignment:
| Q |
14 |
ttattctagcaactttgtaaagattagagatatcaaaatcaaaaacagtcctctatgccatctaaaatttgacaactcaaagggaatcaaagttgacaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14518491 |
ttattctagcaactttgtaaagattagagatatcaaaatcaaaaacagtcctctatgccatctaaaatttgacaactcaaagggaatcaaagttgacaat |
14518392 |
T |
|
| Q |
114 |
attacaatatcttccccggaaaatagtccaaacactgatggcattcacttgcaaaatacacaggatgtagaaattcaacactctaatattggaactggta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14518391 |
attacaatatcttccccggaaaatagtccaaacactgatggcattcacttgcaaaatacacaggatgtagaaattcaacactctaatattggaactggta |
14518292 |
T |
|
| Q |
214 |
agacatgcattaaattaatttattttatatgactatctat |
253 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14518291 |
aga----cattaaattaatttattttatatgactatctat |
14518256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University