View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17754_low_32 (Length: 242)
Name: NF17754_low_32
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17754_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 102
Target Start/End: Complemental strand, 8442737 - 8442654
Alignment:
| Q |
17 |
aggaaagtggtgttagcaattagttgcattttatggatattaacatggtttatattgattatgagtgtgcatatttgaaatagtat |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8442737 |
aggaaagtagtgttagcaattagttgcattttatggat--taacaaggttaatattgattatgagtgtgcatatttgaaatagtat |
8442654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 53 - 114
Target Start/End: Complemental strand, 8436666 - 8436605
Alignment:
| Q |
53 |
atattaacatggtttatattgattatgagtgtgcatatttgaaatagtatgtattttcatta |
114 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8436666 |
atattaacaaggttaatattgattatgagtgtgcatatttgaaatagtatgtattttcatta |
8436605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 154 - 224
Target Start/End: Complemental strand, 8436205 - 8436135
Alignment:
| Q |
154 |
aaatttgaaaataatatttctcnnnnnnngcagtgatgatttcttaaacggtttgtgcaacgacatttgca |
224 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8436205 |
aaatttgaaaataatatttctctttttttgcagtgatgatttcttaaacggtttgtgcaacgacatttgca |
8436135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 132 - 211
Target Start/End: Complemental strand, 8442621 - 8442543
Alignment:
| Q |
132 |
tcattatgaggaattagtgtgcaaatttgaaaataatatttctcnnnnnnngcagtgatgatttcttaaacggtttgtgc |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
8442621 |
tcattatgaggaatgtgtgtgcaaatttgaaaataatatttctc-ttttttgcagtgatgatttctcaaacggtttgtgc |
8442543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 102
Target Start/End: Complemental strand, 8446988 - 8446931
Alignment:
| Q |
45 |
ttttatggatattaacatggtttatattgattatgagtgtgcatatttgaaatagtat |
102 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||||||||| |||||| |||||| |
|
|
| T |
8446988 |
ttttatggatatgaacaaggttaatattgattatgagtgtgcatctttgaagtagtat |
8446931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 67 - 102
Target Start/End: Complemental strand, 11309548 - 11309513
Alignment:
| Q |
67 |
tatattgattatgagtgtgcatatttgaaatagtat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11309548 |
tatattgattatgagtgtgcatatttgaaatagtat |
11309513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University