View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17754_low_37 (Length: 206)
Name: NF17754_low_37
Description: NF17754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17754_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 47615576 - 47615752
Alignment:
| Q |
11 |
atcatcagaagctctaacaacagcagcttgtttcgaacagtaaagcgcatcagtgttatgactcatacacgcgatgcaaccgttatccgaaaagtttctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47615576 |
atcatcagaagctctaacaacagcagcttgtttcgaacagtaaagcgcatcagtgttatgactcatacacgcgatgcaaccgttgtccgaaaagtttctt |
47615675 |
T |
 |
| Q |
111 |
gcaacagaagcatctaaggcctgatgatactgtttggtaatttcaactcgaccacctaagccggcccccagtgtctc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47615676 |
gcaacagaagcatctaaggcctgatgatactgtttggtaatttcaactcgaccacctaagccggcccccagtgtctc |
47615752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 106
Target Start/End: Original strand, 36369046 - 36369094
Alignment:
| Q |
58 |
catcagtgttatgactcatacacgcgatgcaaccgttatccgaaaagtt |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || || || |||||||| |
|
|
| T |
36369046 |
catcagtgttatgacacatacacgcgatgcatccattgtcggaaaagtt |
36369094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University