View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17755_high_53 (Length: 262)

Name: NF17755_high_53
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17755_high_53
NF17755_high_53
[»] chr4 (4 HSPs)
chr4 (17-244)||(33750736-33750963)
chr4 (17-161)||(33719254-33719398)
chr4 (24-128)||(33735931-33736035)
chr4 (26-163)||(33721264-33721392)
[»] chr6 (1 HSPs)
chr6 (18-94)||(32575079-32575155)


Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 33750736 - 33750963
Alignment:
17 aatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33750736 aatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactg 33750835  T
117 ggaacacttttaattagttcctgaactcaacaacaatggaacagttacttgtgtaaattagtgcgtgtttgaccgaggttaaggtattgattagcttcgc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33750836 ggaacacttttaattagttcctgaactcaacaacaatggaacagttacttgtgtaaattagtgcgtgtttgaccgaggttaaggtattgattagcttcgc 33750935  T
217 tttgcaacaatgtgcataatctttcttc 244  Q
    ||||||||||||||||||||||||||||    
33750936 tttgcaacaatgtgcataatctttcttc 33750963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 17 - 161
Target Start/End: Original strand, 33719254 - 33719398
Alignment:
17 aatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactg 116  Q
    |||| |||||||||||||| ||||||  |||| ||| |||||||||||||| | |||| ||||||||| |||  |||||||||||||| ||| || || |    
33719254 aataaggattgtgattttttggatagcattggtgaacctgattttcaacaatttatgaagtttatggaattttctggagattcttctggttctaggacag 33719353  T
117 ggaacacttttaattagttcctgaactcaacaacaatggaacagt 161  Q
    ||||  |||||||||||||| |||| ||||||||||  |||||||    
33719354 ggaatccttttaattagttcatgaattcaacaacaaatgaacagt 33719398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 24 - 128
Target Start/End: Original strand, 33735931 - 33736035
Alignment:
24 attgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactgggaacac 123  Q
    |||||||||||||||||||  | || ||| |||||||||||||||| ||||||||||||||||||| | ||||||||||||| || |||||  |||||||    
33735931 attgtgatttttgggatagtatcggagaagctgattttcaacaactaatgaggtttatggattttgatagagattcttctgactcaagaacatggaacac 33736030  T
124 tttta 128  Q
    |||||    
33736031 tttta 33736035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 163
Target Start/End: Original strand, 33721264 - 33721392
Alignment:
26 tgtgatttttgggataggcttggggaaa---ctgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactgggaaca 122  Q
    |||||||||||||||||  ||||||||    |||||||||||||||| ||||||||||||||||            ||||| |||| ||||| || ||||    
33721264 tgtgatttttgggatagtattggggaagaagctgattttcaacaacttatgaggtttatggatt------------cttctcattctagaacaggaaaca 33721351  T
123 cttttaattagttcctgaactcaacaacaatggaacagtta 163  Q
    |||||||||||||||| || ||||||||||  |||||||||    
33721352 cttttaattagttcctcaattcaacaacaacagaacagtta 33721392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 32575079 - 32575155
Alignment:
18 atatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtgga 94  Q
    ||||||||||||| |||||||||| | ||||||||  ||| ||||  ||| | ||||||||||||||||||||||||    
32575079 atatggattgtgaattttgggatatgattggggaaggtgaatttcggcaagttatgaggtttatggattttggtgga 32575155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University