View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_high_68 (Length: 237)
Name: NF17755_high_68
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 48063088 - 48063308
Alignment:
| Q |
1 |
tttgttcctcttaatgacaacatgcttgactattggtctgcgaggccgagagtcgtgatggtagtactagtaatacaaaaataaaagcaacgattcatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48063088 |
tttgttcctcttaatgacaacatgcttgactattggtctgcgaggccgagagtcgtgatggtagtactagtaatacaaaaataaaagcaacgattcatcc |
48063187 |
T |
|
| Q |
101 |
cctggtgcaaagcacaggtgtctatgtgaaaacaatataagcattagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaa |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48063188 |
cctggtgcaaagcacaggtatctatgtgaaaacaatataagcattagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaa |
48063287 |
T |
|
| Q |
201 |
tggttgtaaggagacactatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48063288 |
tggttgtaaggagacactatg |
48063308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 48067193 - 48067270
Alignment:
| Q |
143 |
attagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaatggttgtaaggagacactat |
220 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| | || ||||||||||||| |||||||||| |
|
|
| T |
48067193 |
attagcttaccctctcaatgctgtcggcttggtgtgatctccattgtgttttgttgaatggttgtaaagagacactat |
48067270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 220
Target Start/End: Original strand, 48100243 - 48100318
Alignment:
| Q |
145 |
tagcttaccctctcaatgctgctatcttggtgtgacctccattgctctctggtgaatggttgtaaggagacactat |
220 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||||| |||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
48100243 |
tagcttaccctctcaacgctatcgtcttgctgtgatctccattgtttcttggtgaatggttgtaaggagacactat |
48100318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University