View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_high_73 (Length: 222)
Name: NF17755_high_73
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_high_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 37358086 - 37358286
Alignment:
| Q |
19 |
attttatttttatttcatataggtccttgtggttcaggnnnnnnncggtagactcagtggtaaaggaatatggaaattgcctactggagctgttaatgag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37358086 |
attttatttttatttcatataggtccttgtggttcaggaaaaaaacggtagattcagtggtaaaggaatatggaaattgcctactggagctgttaatgag |
37358185 |
T |
 |
| Q |
119 |
gtatatatgttaaaaatttatcattgattgttaaacttttgaaagattagtttttaacttcatttgaattcaatttgcagggtgaggatgtctgtgctgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37358186 |
gtatatatgttaaaaatttatcattgattgttaaacttttgaaagattagtttttaacttcatttgaattcaatttgcagggtgaggatgtttgtgctgc |
37358285 |
T |
 |
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
37358286 |
t |
37358286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 80 - 123
Target Start/End: Complemental strand, 973691 - 973648
Alignment:
| Q |
80 |
aaaggaatatggaaattgcctactggagctgttaatgaggtata |
123 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
973691 |
aaaggaatatggaaatcacctactagagctgttaatgaggtata |
973648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University