View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_high_76 (Length: 215)
Name: NF17755_high_76
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_high_76 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 9 - 120
Target Start/End: Original strand, 35420801 - 35420912
Alignment:
| Q |
9 |
gagaatcataggtagtagaagtgagtgaaacaaggtgatgagtgtcaccttttttggttggagggtgatggataagaggcattgtaagggacaaagcttt |
108 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35420801 |
gagaaccataggtagtggaagtgagtgaaacaaggtgatgagtgtcaccttttttggttggagggtgatggataagaggcattgtaagggacaaagcttt |
35420900 |
T |
 |
| Q |
109 |
tctaactggtgg |
120 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35420901 |
tctaactggtgg |
35420912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 109
Target Start/End: Original strand, 19988742 - 19988836
Alignment:
| Q |
15 |
cataggtagtagaagtgagtgaaacaaggtgatgagtgtcaccttttttggttggagggtgatggataagaggcattgtaagggacaaagctttt |
109 |
Q |
| |
|
||||||| || || ||||| ||||||||||||||||| ||||||||| | |||||||||||||| | ||||||||||| || |||| ||||||| |
|
|
| T |
19988742 |
cataggtggtggaggtgagggaaacaaggtgatgagtatcaccttttcttgttggagggtgatgcacaagaggcattgggagagacatagctttt |
19988836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University