View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_high_78 (Length: 211)
Name: NF17755_high_78
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_high_78 |
 | |
|
| [»] scaffold0459 (1 HSPs) |
| | |
|
| [»] scaffold0366 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0459 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 4567 - 4359
Alignment:
| Q |
1 |
ttacatatatattattccctatgtgatgcttccataaaattttgttaatagatctagaagggttaaatgagcctagtccgaactaaattgtgggttggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4567 |
ttacatatatattattccctatgtgatgcttccataaaattttgttaatagatctagaagtgttaaatgagcctagtccgaactaaattgtgggttggct |
4468 |
T |
|
| Q |
101 |
aaacaaaaaatttgcttttaataattttaatctaacctgtccttgatattgatggattggaccaaccacgggataaaaaagtatatacttaattgcagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4467 |
aaacaaaaaatttgcttttaataattttaatctaacctgtccttgatattgatggattggaccaaccacgggataaaaaagtatatacttaattgcagtt |
4368 |
T |
|
| Q |
201 |
tttgtcttc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
4367 |
tttgtcttc |
4359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 4567 - 4359
Alignment:
| Q |
1 |
ttacatatatattattccctatgtgatgcttccataaaattttgttaatagatctagaagggttaaatgagcctagtccgaactaaattgtgggttggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4567 |
ttacatatatattattccctatgtgatgcttccataaaattttgttaatagatctagaagtgttaaatgagcctagtccgaactaaattgtgggttggct |
4468 |
T |
|
| Q |
101 |
aaacaaaaaatttgcttttaataattttaatctaacctgtccttgatattgatggattggaccaaccacgggataaaaaagtatatacttaattgcagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4467 |
aaacaaaaaatttgcttttaataattttaatctaacctgtccttgatattgatggattgnaccaaccacgggataaaaaagtatatacttaattgcagtt |
4368 |
T |
|
| Q |
201 |
tttgtcttc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
4367 |
tttgtcttc |
4359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University