View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_low_27 (Length: 426)
Name: NF17755_low_27
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 136 - 417
Target Start/End: Original strand, 48139496 - 48139777
Alignment:
| Q |
136 |
gcaagcaatgcagcattattcggttatggcggaatcgaaagaattgaaagaacggttatggaaacttgttaaaactatcgttgactctgatgatgactat |
235 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48139496 |
gcaagcaatgcagcagcattcggttatggcggaatcgaaagaattgaaagaacggttatggaaacttgttaaaactatcgttgactctgatgatgactat |
48139595 |
T |
|
| Q |
236 |
tctctgcaaaccaccgatgatgctatcgctactctttcttctctcaaagatttcaaaatcaagaacaagaacaacaactctcttagtagtaagaatggaa |
335 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48139596 |
tctctgcaaaccaccgatgatgctatctctactctttcttctctcaaagatttcaaaatcaagaacaagaacaagaactctcttagtagtaagaatggaa |
48139695 |
T |
|
| Q |
336 |
caacaaaatctttctctcataaatttgaccattttgcccctccttctcattttctttgccctatttcttctcaattgatgat |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48139696 |
caacaaaatctttctctcataaatttgaccattttgcccctccttctcattttctttgccctatttcttctcaattgatgat |
48139777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 48139382 - 48139424
Alignment:
| Q |
19 |
ttgtgttattgtttgtttgtctgttagtgatttaattagaatt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48139382 |
ttgtgttattgtttgtttgtctgttagtgatttaattagaatt |
48139424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University