View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17755_low_54 (Length: 298)

Name: NF17755_low_54
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17755_low_54
NF17755_low_54
[»] chr3 (2 HSPs)
chr3 (19-135)||(48769372-48769488)
chr3 (198-296)||(48769484-48769581)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 135
Target Start/End: Original strand, 48769372 - 48769488
Alignment:
19 aaaaccttcaaaaatattctttagcggtggcagagaacgatagaacaatactataacaaaatatggaggacatcactaaaaaatggaagacaaaaataca 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
48769372 aaaaccttcaaaaatattctttagcggtggcagagaacgatagaacaatactataacaaaatatggaggacatcactaaaaaatggaagacaaaagtaca 48769471  T
119 aaatcaggctatatatt 135  Q
    |||||||||||||||||    
48769472 aaatcaggctatatatt 48769488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 198 - 296
Target Start/End: Original strand, 48769484 - 48769581
Alignment:
198 atattgtaagaaatggaaaaatttcggaaagaaacattaatacgaaaatactgataaaatatccatgacatgattcccttgtgaaatattcttcgacat 296  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
48769484 atattgtaagaaatggaaaaatttcggaaagaaacattaatacgaaaatactgataaaatatccatgacatgattcccttgtgaaatatt-ttcgacat 48769581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University