View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_low_62 (Length: 265)
Name: NF17755_low_62
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 52732324 - 52732457
Alignment:
| Q |
127 |
gaaatttataatcaaatttggcagtgagcacttgatttataataaaattaatggattaaaggaaattaatgaagtgtaccacttctaaagtaggcataat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52732324 |
gaaatttataatcaaatttggcagtgggcacttgatttataatcaaattaatggattaaaggaaattaatgaagtgtaccacttctaaagtaggcataat |
52732423 |
T |
|
| Q |
227 |
atgcggactggttgcaagatgaacctatgcttct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52732424 |
atgcggactggttgcaagatgaacctatgcttct |
52732457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 52732176 - 52732300
Alignment:
| Q |
1 |
agtctaggttgggatatacttgtttatttaaaatatgatcatgaaggatttttaacaatagtatagctttgtgctagcttcttttagtggtacttacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52732176 |
agtctaggttgggatatacttgtttatttaaaatatgatcatgaaggatttctaacaatagtatagctttgtgctagcttcttttagtggtacttacatt |
52732275 |
T |
|
| Q |
101 |
ataaaaatacacacagccgtaccaa |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52732276 |
ataaaaatacacacagccgtaccaa |
52732300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University