View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_low_64 (Length: 262)
Name: NF17755_low_64
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 33750736 - 33750963
Alignment:
| Q |
17 |
aatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33750736 |
aatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactg |
33750835 |
T |
|
| Q |
117 |
ggaacacttttaattagttcctgaactcaacaacaatggaacagttacttgtgtaaattagtgcgtgtttgaccgaggttaaggtattgattagcttcgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33750836 |
ggaacacttttaattagttcctgaactcaacaacaatggaacagttacttgtgtaaattagtgcgtgtttgaccgaggttaaggtattgattagcttcgc |
33750935 |
T |
|
| Q |
217 |
tttgcaacaatgtgcataatctttcttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33750936 |
tttgcaacaatgtgcataatctttcttc |
33750963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 17 - 161
Target Start/End: Original strand, 33719254 - 33719398
Alignment:
| Q |
17 |
aatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactg |
116 |
Q |
| |
|
|||| |||||||||||||| |||||| |||| ||| |||||||||||||| | |||| ||||||||| ||| |||||||||||||| ||| || || | |
|
|
| T |
33719254 |
aataaggattgtgattttttggatagcattggtgaacctgattttcaacaatttatgaagtttatggaattttctggagattcttctggttctaggacag |
33719353 |
T |
|
| Q |
117 |
ggaacacttttaattagttcctgaactcaacaacaatggaacagt |
161 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
33719354 |
ggaatccttttaattagttcatgaattcaacaacaaatgaacagt |
33719398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 24 - 128
Target Start/End: Original strand, 33735931 - 33736035
Alignment:
| Q |
24 |
attgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactgggaacac |
123 |
Q |
| |
|
||||||||||||||||||| | || ||| |||||||||||||||| ||||||||||||||||||| | ||||||||||||| || ||||| ||||||| |
|
|
| T |
33735931 |
attgtgatttttgggatagtatcggagaagctgattttcaacaactaatgaggtttatggattttgatagagattcttctgactcaagaacatggaacac |
33736030 |
T |
|
| Q |
124 |
tttta |
128 |
Q |
| |
|
||||| |
|
|
| T |
33736031 |
tttta |
33736035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 26 - 163
Target Start/End: Original strand, 33721264 - 33721392
Alignment:
| Q |
26 |
tgtgatttttgggataggcttggggaaa---ctgattttcaacaactgatgaggtttatggattttggtggagattcttctgattccagaactgggaaca |
122 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||| ||||| |||| ||||| || |||| |
|
|
| T |
33721264 |
tgtgatttttgggatagtattggggaagaagctgattttcaacaacttatgaggtttatggatt------------cttctcattctagaacaggaaaca |
33721351 |
T |
|
| Q |
123 |
cttttaattagttcctgaactcaacaacaatggaacagtta |
163 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
33721352 |
cttttaattagttcctcaattcaacaacaacagaacagtta |
33721392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 32575079 - 32575155
Alignment:
| Q |
18 |
atatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggattttggtgga |
94 |
Q |
| |
|
||||||||||||| |||||||||| | |||||||| ||| |||| ||| | |||||||||||||||||||||||| |
|
|
| T |
32575079 |
atatggattgtgaattttgggatatgattggggaaggtgaatttcggcaagttatgaggtttatggattttggtgga |
32575155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University