View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_low_66 (Length: 256)
Name: NF17755_low_66
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_low_66 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 23 - 256
Target Start/End: Complemental strand, 39676068 - 39675836
Alignment:
| Q |
23 |
cagagagtgcctaaaatggtgatttggtatgattttaaagatgttatgattcttaatgttgatggcaacactattaggaatcatggagttgtcggtttgg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676068 |
cagagagtgcctaaaatggtgatttggtatgattttaaagatgttatgattcttaatgttgatggcaacactattaggaatcatggagttgtcggtttgg |
39675969 |
T |
|
| Q |
123 |
gtggcttggtgcaatttgatagtgatgattgcataattggactttatggtcacattgcctgcaataataaccttcatgtataattactagccattttgta |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
39675968 |
gtggcttggtgcaatttgatagtgatgattgcataattggattttatggtcacattgcctgcaacaataaccttcatgtataattacta-ccattttgta |
39675870 |
T |
|
| Q |
223 |
aaggattcgcattagtttattttcttgtttatat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39675869 |
aaggattcgcattagtttattttcttgtttatat |
39675836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University