View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17755_low_72 (Length: 248)
Name: NF17755_low_72
Description: NF17755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17755_low_72 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 46602562 - 46602789
Alignment:
| Q |
1 |
atattaggtatgtgtatcccctctcttatatatcaaacatttctttcatttctattcgacggggaacttaaccacttacatttgaaactcaataggttca |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46602562 |
atattaggtatgtgtgtcccctctcttatatatcaaatatttttttcatttctattcgacgtggaacttaaccacttacatttgaaactcagtaggttca |
46602661 |
T |
|
| Q |
101 |
tggttctctctcttatattgtttatgggttctatccctaaattcacatatttacttttataaatgattacttgtgtatcgtagtgtcttttgcatgtatc |
200 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46602662 |
tggttctc--tcttatattatttatgggttctatccctaaattcacatatttacttttataattaattacttgtgtatcgtagtgtcttttgcatgtatc |
46602759 |
T |
|
| Q |
201 |
ccattgtttcaaccactcgttgaagttcgt |
230 |
Q |
| |
|
|| ||||||||||||||| |||||||||| |
|
|
| T |
46602760 |
ccgttgtttcaaccactcactgaagttcgt |
46602789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 54
Target Start/End: Original strand, 2630127 - 2630160
Alignment:
| Q |
21 |
ctctcttatatatcaaacatttctttcatttcta |
54 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
2630127 |
ctctcttatatatctaacatttctttcatttcta |
2630160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 19547935 - 19547895
Alignment:
| Q |
19 |
ccctctcttatatatcaaacatttctttcatttctattcga |
59 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
19547935 |
ccctctcttatatatccaacatttcttccatttctagtcga |
19547895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University