View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17756_low_17 (Length: 254)
Name: NF17756_low_17
Description: NF17756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17756_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 55172862 - 55172623
Alignment:
| Q |
15 |
atcatgataactttgagaaatatataatgcatcgtgcaggttagaatctttgagaagcctggaacaagcacatgttctgcttttatcaccaataaccata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
55172862 |
atcatgataactttgagaaatatataatgcatcgtgcaggttagaatctttgagaagcctggaacaagcacatgttctgcttttatcaccaataaccaca |
55172763 |
T |
|
| Q |
115 |
ctaatcaagcagccacaattagtttcagaggttctaactactttttgccagcacattccattagcgtcctcccagattgcaagactgtcgtctacaacac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55172762 |
ctaatcaagcagccacaattagtttcagaggttctaactactttttgccagcacattccattagcgtcctcccagattgcaagactgtcgtctacaacac |
55172663 |
T |
|
| Q |
215 |
acaaagtgtaatgaaccaacttgtttattataaactaatc |
254 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
55172662 |
acaaaatgtaatgaaccaacttgtttattataaactaatc |
55172623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 135 - 225
Target Start/End: Original strand, 27722664 - 27722754
Alignment:
| Q |
135 |
agtttcagaggttctaactactttttgccagcacattccattagcgtcctcccagattgcaagactgtcgtctacaacacacaaagtgtaa |
225 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||| |||||| ||| | || || |||||||||||||| |||| |||||| |||| ||||| |
|
|
| T |
27722664 |
agtttcagaggttcagactattttttgccaccacgttccatcagcattcttcctgattgcaagactgtggtcttcaacactcaaaatgtaa |
27722754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University