View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17756_low_23 (Length: 212)
Name: NF17756_low_23
Description: NF17756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17756_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 41787830 - 41788042
Alignment:
| Q |
1 |
acgaaccacgtgttaaatttcatgaaccaccatggaaatcacaatagaaagaagtcacacctnnnnnnnnn-gttataacagactatatctatcaggtaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41787830 |
acgaaccacgtgttaaatttcatgaaccaccatggaactaacaatagaaagaagtcacacctaaaaaaaaaagttataacagactatatctatcaggtaa |
41787929 |
T |
 |
| Q |
100 |
aaccacgtagtccaactctggaccctattcgacatatgtctcagtttttcattcattcgtctctctcagctctgccgtttttacttggactaagagcaac |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787930 |
aaccacgtagtccacctctggaccctattcgacatatgtctcagtttttcattcattcgtctctctcagctctgccgtttttacttggactaagagcaac |
41788029 |
T |
 |
| Q |
200 |
tccaatgctagtt |
212 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
41788030 |
tccaatcctagtt |
41788042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University