View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17756_low_24 (Length: 211)
Name: NF17756_low_24
Description: NF17756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17756_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 93 - 193
Target Start/End: Original strand, 1335320 - 1335422
Alignment:
| Q |
93 |
tgatcggttcaattattttatagctaaaccgtagaactttcgttttttgagagga--gtttcatataaaataattgctttcaaccgttggaaaaggtgaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1335320 |
tgatcggttcaattattttatagctaaacagtagaactttcgttttttgagaggaactattcatataaaataattgttttgaaccgttggaaaaggtgaa |
1335419 |
T |
|
| Q |
191 |
ata |
193 |
Q |
| |
|
||| |
|
|
| T |
1335420 |
ata |
1335422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 13 - 71
Target Start/End: Original strand, 1334642 - 1334700
Alignment:
| Q |
13 |
taatgttattttaatctaaccttagtcattcttagaaatgaatcttttaaaagaattta |
71 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1334642 |
taatgttattttaatctaaccttggtcattcttagaaatgaattttttaaaagaattta |
1334700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University