View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17756_low_9 (Length: 384)
Name: NF17756_low_9
Description: NF17756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17756_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 4e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 24 - 228
Target Start/End: Original strand, 6728611 - 6728816
Alignment:
| Q |
24 |
tcacaactattgaaaaaagttcttgtgccttatattattatatggtttccnnnnnnntttagcttggcttgctgactaggagatgactttaatttct-aa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6728611 |
tcacaactattgaaaaaagttcttgtgccttatattattatatggtttccaaaaaaatttagcttggcttgctgactaggagatgactttaatttcttaa |
6728710 |
T |
 |
| Q |
123 |
tttattaacaaatactcatattgctaattgttaatcctaacacttagtgcctgtaaaatagagatctcttttatacatcaactcgaatgtgattcaaacg |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6728711 |
tttattaacaaatactcacattgctaattgttaatcctaacacttagtgcttgtaaaatagagatctcttttatacataaactcgaatgtgattcaaacg |
6728810 |
T |
 |
| Q |
223 |
tgatta |
228 |
Q |
| |
|
|||||| |
|
|
| T |
6728811 |
tgatta |
6728816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University