View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17757_high_10 (Length: 229)
Name: NF17757_high_10
Description: NF17757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17757_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 84 - 219
Target Start/End: Complemental strand, 48570436 - 48570301
Alignment:
| Q |
84 |
gctactttgttggaataaatcgatatcattaagttagattcttcgactcatatggaagcacttaaatcgatatcatgtgatattcacagcctatcaccac |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48570436 |
gctactttgttggaataaatcgatatcattaagttagattcttcgactcatatggaagcacttaaatcgatatcatgtgatattcacagcctctcaccac |
48570337 |
T |
 |
| Q |
184 |
aagtgataatgtttgctattaattttgtttttatat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570336 |
aagtgataatgtttgctattaattttgtttttatat |
48570301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 48570505 - 48570471
Alignment:
| Q |
15 |
ggccatttctaccatttccttccgagtacttcacc |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570505 |
ggccatttctaccatttccttccgagtacttcacc |
48570471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University