View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17757_high_6 (Length: 266)
Name: NF17757_high_6
Description: NF17757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17757_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 39 - 242
Target Start/End: Complemental strand, 10231457 - 10231254
Alignment:
| Q |
39 |
acctcaatgctgagccacctgtatgcaaaattctcctgtgtaatttgacttcttattttgctttggtatgatatagccttctttatggagctgaagaccc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10231457 |
acctcaatgctgagccacctgtatgcaagattctcctgtgtaatttgacttcttattttgctttggtatgatatagccttctttatggagctgaagaccc |
10231358 |
T |
 |
| Q |
139 |
ttctattgctggactggtgttggacagcgccttttcaaacttgtacgacttgatgatggagcttgttgatgtctataaaatccgacttccaaaattcact |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10231357 |
ttctattgctggactggtgttggacagcgccttttcaaacttgtacgacttgatgatggagcttgttgatgtctataaaatccgacttccaaaattcact |
10231258 |
T |
 |
| Q |
239 |
gtaa |
242 |
Q |
| |
|
|||| |
|
|
| T |
10231257 |
gtaa |
10231254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 95 - 237
Target Start/End: Complemental strand, 56247834 - 56247692
Alignment:
| Q |
95 |
tttgctttggtatgatatagccttctttatggagctgaagacccttctattgctggactggtgttggacagcgccttttcaaacttgtacgacttgatga |
194 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||| |||| ||||| ||||||||||| ||||| || | | |||| |
|
|
| T |
56247834 |
tttgctttggtgggatttagccttctttatggagccgaagacccttctattgctggaatggtattggatagcgccttttctaacttatataatctcatga |
56247735 |
T |
 |
| Q |
195 |
tggagcttgttgatgtctataaaatccgacttccaaaattcac |
237 |
Q |
| |
|
|||||||||| || || ||||||||||| |||||||| ||||| |
|
|
| T |
56247734 |
tggagcttgtggacgtttataaaatccggcttccaaagttcac |
56247692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University