View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17757_low_8 (Length: 293)
Name: NF17757_low_8
Description: NF17757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17757_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 16 - 284
Target Start/End: Complemental strand, 42217157 - 42216889
Alignment:
| Q |
16 |
gttttcttgtgcagcaaggtgataggagcaaaatacttcaacctcgacccatctggtccaaccatcgagaacccaagtccggttgatgatcagggccatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42217157 |
gttttcttgtgcagcaaggtgataggagcaaaatacttcaacctcgacccatctggtccaaccatcgagaacccaagtccggtggatgatcagggccatg |
42217058 |
T |
 |
| Q |
116 |
gcactcacacttcgtcgacagcggctggatcagtggtgaggggtgcaagtctttatggcattggtaaaggcaatgcccgtggcggtgtcctatcagcacg |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42217057 |
gcactcacacttcgtcgacagcagctggatcagtggtgagaggtgcaagtctttatggcattggtaaaggcaatgcccgtggcggtgtcccatcagcacg |
42216958 |
T |
 |
| Q |
216 |
tattgcaatgtataaagtttgttggaccattgggtgcagtgacatggacatgcttgctggctttgatga |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42216957 |
cattgcaatgtataaagtttgttggaccattgggtgcagtgacatggacatgcttgctggctttgatga |
42216889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University