View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_high_13 (Length: 478)
Name: NF17758_high_13
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 6e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 257 - 418
Target Start/End: Complemental strand, 26644302 - 26644142
Alignment:
| Q |
257 |
aacccgcgtggggtaatacatatgcatcatgttgtgatatggatgttgtaggattatctgatacatgtggatactaccgaagtttgttaatgtatgcctc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26644302 |
aacccgcgtggggtaatacatatgcatcatgttgttatatggatgttgtaggatgatctgatacatgtggatacgaccgaagtttgttaatgtatgcctc |
26644203 |
T |
|
| Q |
357 |
aacaaaaatatttactgtgcgaaaatacatttctccccccaatgagtttatgtcagctcaac |
418 |
Q |
| |
|
||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26644202 |
aac-aaaatatttactgtgcgaacatacatttctccccccaatgagtttatgtcagctcaac |
26644142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 26645337 - 26645263
Alignment:
| Q |
21 |
catagtcaaccttccaatatgctcgatagttgattttccatcttcccccgaaaaggtggcgaagtcagaaatctt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
26645337 |
catagtcaaccttccaatatgctcgatagttgattttccatcttcccccgaaaaggtgacgaagtcaggaatctt |
26645263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 31 - 71
Target Start/End: Original strand, 15919082 - 15919122
Alignment:
| Q |
31 |
cttccaatatgctcgatagttgattttccatcttcccccga |
71 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
15919082 |
cttccaataagctaaatagttgattttccatcttcccccga |
15919122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University