View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_high_36 (Length: 290)
Name: NF17758_high_36
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 10 - 274
Target Start/End: Complemental strand, 39076087 - 39075811
Alignment:
| Q |
10 |
aagaatatagaacagttcaaacttcatcttcagaagtaagaatgtctacaacatggaattcataaacaccacctttggcacacaaaaattgtaaagttta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076087 |
aagaatatagaacagttcaaacttcatcttcagaagtaacaatgtctacaacatggaattcataaacaccacctttggcacacaaaaattgtaaagttta |
39075988 |
T |
 |
| Q |
110 |
taaaatgcatgttccagagtaaatcaaagtggaatgatcct------------acacgtagctaagatagtaaaaatgcaattacaaacagcaacacagt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075987 |
taaaatgcatgttccagagtaaatcaaagtggaatgatcctacacatgcatatacacatagctgagatagtaaaaatgcaattacaaacagcaacacagt |
39075888 |
T |
 |
| Q |
198 |
catcaatctcaagaaatttatgaaataattcaataacttatttcgtccggtcaagacacaacatagggctaataact |
274 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39075887 |
catcaatctcaagaagtttatgaaataattcaataacttatttcgtccggtcgagacacaacatagggctaataact |
39075811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University