View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_high_47 (Length: 247)
Name: NF17758_high_47
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_high_47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 8 - 247
Target Start/End: Original strand, 4527879 - 4528118
Alignment:
| Q |
8 |
cacagacagaagctgaagcagactatttaacctatcaatttgctataattgaaaatatatattgctaatgccttaatagaaaaatgaaattggagcagca |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4527879 |
cacagacagaagctgaagcaaactatttaacctatcaatttactataattgaaaatatatattgctaatgccttaatagaaaaatgaaattggagcagca |
4527978 |
T |
 |
| Q |
108 |
gggcatatgaaaagttacctttggttcatcatgtgacctagttgagtagttgtaatatgaattttggattgaaggggactctagatgattgtgtgatcca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4527979 |
gggcatatgaaaagttacctttggttcatcatgtgacctagttgagtagttgtaatatgaattttggattgaaggggactctagatgattgtgtgatcca |
4528078 |
T |
 |
| Q |
208 |
attgacaatgatcctgaagaagcttggttaccaccagtcc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4528079 |
attgacaatgatcctgaagaagcttggttaccaccagtcc |
4528118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 231
Target Start/End: Original strand, 16994339 - 16994416
Alignment:
| Q |
154 |
tagttgtaatatgaattttggattgaaggggactctagatgattgtgtgatccaattgacaatgatcctgaagaagct |
231 |
Q |
| |
|
|||||||||| || ||||||||||||| || ||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
16994339 |
tagttgtaattggagttttggattgaagagggctctagatgattgtgcaatccagttgacaatgatcctgaagaagct |
16994416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University