View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17758_high_48 (Length: 238)

Name: NF17758_high_48
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17758_high_48
NF17758_high_48
[»] chr2 (1 HSPs)
chr2 (1-222)||(4528110-4528339)
[»] chr4 (1 HSPs)
chr4 (61-221)||(16994483-16994646)


Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 4528110 - 4528339
Alignment:
1 caccagtcccatgaaattgattcatctgcattacaattaaaatttcatgcaca--------caatttaattaaaactttaggtcacaaaatagataatga 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||    
4528110 caccagtcccatgaaattgattcatctgcattacaattaaaatttcatgcacacatacacacaatttaattaaaactttaggtcacaaaatagataatga 4528209  T
93 ctaaaaccttaccatggggggtgaatagccattgtttctcttttgaattgttgtagggtaagaccaaccatgatttgattcactagacaaattcctaggt 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4528210 ctaaaaccttaccatggggggtgaatagccattgtttctcttttgaattgttgtagggtaagaccaaccatgatttgattcactagacaaattcctaggt 4528309  T
193 ggagaatttccagaatcagattggcttcct 222  Q
    ||||||||||||||||||||||||||||||    
4528310 ggagaatttccagaatcagattggcttcct 4528339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 61 - 221
Target Start/End: Original strand, 16994483 - 16994646
Alignment:
61 attaaaactttaggtcacaaaatagataatgactaaaaccttaccatgggg---ggtgaatagccattgtttctcttttgaattgttgtagggtaagacc 157  Q
    ||||| |||||||||||||| ||| ||| |||||||||||| ||||| ||    |||| ||| ||||||||||||||||||||  | | |||||||||||    
16994483 attaagactttaggtcacaatataaatattgactaaaacctcaccataggttttggtggataaccattgtttctcttttgaatattggcagggtaagacc 16994582  T
158 aaccatgatttgattcactagacaaattcctaggtggagaatttccagaatcagattggcttcc 221  Q
    |||||||||| |||||||||| |||| |||||| |||||||||| ||| |||||||||||||||    
16994583 aaccatgattggattcactagccaaactcctagatggagaattttcaggatcagattggcttcc 16994646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University