View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_high_52 (Length: 219)
Name: NF17758_high_52
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_high_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 28 - 205
Target Start/End: Complemental strand, 15570115 - 15569935
Alignment:
| Q |
28 |
aggtcgagatcttgaaaagatgaaaaactaagaggtgaaccaaattctttcaatagtcccatttcagccattccatgaggtcctacaacaacacccttta |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15570115 |
aggtcgagatcttgaaaagatgaaaaactaagaggtgaaccaaattctttcaatagtcccatttcagccattccatgaggtcctacaacaacacccttta |
15570016 |
T |
|
| Q |
128 |
agttat---ttgtagatgccatgttttcacctgcaagtgtttgataagctttctccaatatactttgcatgtatttccctt |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15570015 |
agttattagttgtagatgccatgttttcacctgcaagtgtttgataagctttctccaatatactttgcatgtatttccctt |
15569935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University