View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_low_28 (Length: 350)
Name: NF17758_low_28
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_low_28 |
 | |
|
| [»] scaffold0190 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0190 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 38 - 284
Target Start/End: Original strand, 12337 - 12583
Alignment:
| Q |
38 |
gaagcataggacaatctatggaccattaaaacatttctttgctggtttggtctagcatctggtcttcgagttaacattgcaaagagtagtattatgtgtg |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12337 |
gaagcataggacaatctatggaccattaaaacatttctttgctggtttggtctagcatctggtcttcgagttaacattgcaaagagtagtattatgtgtg |
12436 |
T |
|
| Q |
138 |
ttcatgtgcatccatannnnnnnagtatgactgagggttgagagtttcctctattgtagagaagattttatcccctttacttactttgggttgcctgttg |
237 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12437 |
ttcatgtgcatccatatttttttagtatgactgagggttgagagtttcctctattgtagagaagattttatcccctttacttactttgggttgcctgttg |
12536 |
T |
|
| Q |
238 |
agggaaaacccttgaaaggaggggacatgggatcctttggttgagct |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12537 |
agggaaaacccttgaaaggaggggacatgggatcctttggttgagct |
12583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0190; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 287 - 327
Target Start/End: Complemental strand, 13909 - 13869
Alignment:
| Q |
287 |
ttaatgacattttgttggatttgaatgtaatcttattatat |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13909 |
ttaatgacattttgtcggatttgaatgtaatcttattatat |
13869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University