View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_low_30 (Length: 345)
Name: NF17758_low_30
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 7609059 - 7609355
Alignment:
| Q |
1 |
aatgttttaaaacctgaaccggactttgatctcatgggatctccgggtcattgttcagccgttttaaacgactcaaatcatgataaaaccacggttaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7609059 |
aatgttttaaaacctgaaccggacattgatctcatgggatctccgggtcattgttcaaccgttttaaacgactcaaatcatgataaaaccacggttaaat |
7609158 |
T |
|
| Q |
101 |
tgtttaaataattgaactatagacaatgctggttaggattctcaatcagctgaatcgtcgaattcacttcga-ttttaaaaacatttgccaaaacttgtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7609159 |
tgtttaaataattgaactatagacaatgctggttaggattctcaatcaactgaatcgtcgaattcacttcgatttttaaaaacatttgccaaaacttgtt |
7609258 |
T |
|
| Q |
200 |
cttttatctattattctttaatgagcgtttgatttgctaattcaatgattagatatcaaaatttcaggtgtatgatg-ttaatttaaaaactacgtt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
7609259 |
cttttatctattattctttaatgagcgtttgatttgctaattcaatgattagatatcaaaatttcagttgtatgatgtttaatttaaaaactacgtt |
7609355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 309 - 337
Target Start/End: Original strand, 7609411 - 7609439
Alignment:
| Q |
309 |
ccgtattgcatatttttgttattttgtct |
337 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7609411 |
ccgtattgcatatttttgttattttgtct |
7609439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University