View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_low_42 (Length: 278)
Name: NF17758_low_42
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 35804118 - 35804368
Alignment:
| Q |
18 |
attagtccattgtgctgcagaataccttgaaatgacggacgaatacgaagaaggcaacttgttgacaaagtcagagagctttttccataaaaatatattg |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35804118 |
attagtccactgtgctgcagaataccttgaaatgacggacgaatacgaagaaggcaacttgttgacaaagtcagagagctttttccataaaaatatattg |
35804217 |
T |
|
| Q |
118 |
cgcaactggaaagattgtattttggctctccagagctctgagcctattctatcaagagctgaaaatcttcatttagtggataaatgtttaaacgctctat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35804218 |
cgcaactggaaagattgtattttggctctccaaagctctgagcctattctatcaagagctgaaaatcttaatttagtggataaatgtttaaacgctctat |
35804317 |
T |
|
| Q |
218 |
ctatgatggcttgcacggacccgagtttatttggatggccgatgatgatgt |
268 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35804318 |
ctatgatggcttgcacagacccgagtttatttggatggccgatgatgatgt |
35804368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University