View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_low_43 (Length: 276)
Name: NF17758_low_43
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 120
Target Start/End: Original strand, 4315549 - 4315651
Alignment:
| Q |
18 |
tgcagcataaattcactccaaaagaatttgcaagaagacataacagaaaccaatacagtgaaatcattcccattagtttaatttgctaacatctccaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4315549 |
tgcagcataaattcactccaaaagaatttgcaagaagacataacagaaaccaatacagtgaaatcattcccattagtttaatttgctaacatctccaact |
4315648 |
T |
|
| Q |
118 |
tga |
120 |
Q |
| |
|
||| |
|
|
| T |
4315649 |
tga |
4315651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 161 - 260
Target Start/End: Original strand, 4315650 - 4315748
Alignment:
| Q |
161 |
gatttagtggtcataattcctaaatataagcaaaaccaaactaattttattatattcaatactattgttttgattttttgtgtttgtgaaccgggtatct |
260 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4315650 |
gatttagtggtcctaattcctaaatataagcaaaaccaa-ctaattttattatattcaatactattgttttgattttttgtgtttgtgaaccgggtatct |
4315748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University