View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_low_55 (Length: 222)
Name: NF17758_low_55
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 48074987 - 48075176
Alignment:
| Q |
17 |
acgaagcactatatctgatgactttaggtggaaatgattttgtgaacaactattttcttgtacctttttctgcaagatcacgccaatttagacttccaga |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48074987 |
acgaagcactatacctgatgactttaggtggaaatgattttgtgaacaactattttcttgtacctttttctgcaagatcacgccaatttagacttccaga |
48075086 |
T |
|
| Q |
117 |
ttatgttgtgtacctcatttctgagtatcgtaaaattcttgcggtattactctactctcttccgatctgtttgctattattatttttagtattat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48075087 |
ttatgttgtgtacctcatttctgagtatcgtaaaattcttgcggtat-----tactctcttccgatctgtttgctattattatttttagtattat |
48075176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 37 - 156
Target Start/End: Complemental strand, 6341760 - 6341641
Alignment:
| Q |
37 |
actttaggtggaaatgattttgtgaacaactattttcttgtacctttttctgcaagatcacgccaatttagacttccagattatgttgtgtacctcattt |
136 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | | || |||| || || ||||| || ||| | ||||| ||||||||||| | |||||||| |
|
|
| T |
6341760 |
actttaggtgggaatgattttgtgaacaactattatttggttccttactcagccagatctcgtgaatatgctcttcctgattatgttgtcttcctcattt |
6341661 |
T |
|
| Q |
137 |
ctgagtatcgtaaaattctt |
156 |
Q |
| |
|
|||| ||||| ||||||||| |
|
|
| T |
6341660 |
ctgaatatcgcaaaattctt |
6341641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University