View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17758_low_56 (Length: 221)
Name: NF17758_low_56
Description: NF17758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17758_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 30 - 203
Target Start/End: Complemental strand, 658230 - 658058
Alignment:
| Q |
30 |
acccaccggcccattatatcaccgttttcgtctgaagctgtctttccacttcattcttcttcttcttcactaaatttcaccaccgaggtaaattttca-n |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
658230 |
acccaccggcccattatatcaccgttttcgtctgaagctgtctttccactt--tcattcttcttcttcactaaatttcaccaccgaggtaaattttcatt |
658133 |
T |
 |
| Q |
129 |
nnnnnnncttcaattcaatttgattaatttctaattagggttaattggaatttcattttcatgtctattaattga |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
658132 |
tttttttcttcaattcaatttgattgatttctaattagggttaattggaatttcattttcatgtctattaattga |
658058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University