View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17760_high_14 (Length: 253)
Name: NF17760_high_14
Description: NF17760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17760_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 18491643 - 18491867
Alignment:
| Q |
18 |
aaaacaggattcaatccaaattctatggcgagactaacatcggttattctaattccaatctccaagtagtccgtgttagtgttgcagtgtgcggcaagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
18491643 |
aaaacaggattcaatccaaattctacggcgagactaacatcggtgactctaattccaatctccaagcagtccgtgttaatgttgcagtgtgcggcaagaa |
18491742 |
T |
 |
| Q |
118 |
tgttccccaacttccacctttcaatggagtttcgagcatcgattgtgaggtgaaagaggaacaaccagttcaaaaaatgacgttcttatgaactatggtt |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18491743 |
tgctccccaacttccacctttcaatggagtttcgagcatcgattgtcaggtgaaagaggaacaaccagttcaaaaaatgacgttcttatgaactatggtt |
18491842 |
T |
 |
| Q |
218 |
gccacactgactctagatgatgatg |
242 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
18491843 |
gccacactaactctagatgatgatg |
18491867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University