View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17760_high_15 (Length: 241)
Name: NF17760_high_15
Description: NF17760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17760_high_15 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 227
Target Start/End: Complemental strand, 113711 - 113497
Alignment:
| Q |
12 |
atgaacacaagtattacagaatttacactaaaatttcaattctccatcccaactataatagcttttcctagccaacaaaaacaaatcaatatccacagaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113711 |
atgaacacaagtattacagaatttacactaaaatttcaattttccatcc-aactataatagcttttcctagccaacaaaaacaaatcaatatccacagaa |
113613 |
T |
|
| Q |
112 |
aaagaataaaattgtcatagggtcttaaaaacagtacaagtacagtgacaaaaccaagaagctgaaaaaccaaagtacaatattggacctaccagttcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113612 |
aaagaataaaattgtcatagggtcttaaaaacagtacaagtacagtgacaaaaccaagaagctgaaaaaccaaagtacaatattggacctaccagttcaa |
113513 |
T |
|
| Q |
212 |
gtttgtttggtaactg |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
113512 |
gtttgtttggtaactg |
113497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University