View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17760_high_2 (Length: 562)
Name: NF17760_high_2
Description: NF17760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17760_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 198 - 549
Target Start/End: Complemental strand, 1445304 - 1444955
Alignment:
| Q |
198 |
ggttcttacttcttactattcctgctgttgggttttggcaactcttaannnnnnnnnnnncaagctttcaacatcaaagttttgtctttgaaaccagtga |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445304 |
ggttcttacttcttactattcctgctgttgggttttggcaactcttaattttttgtttttcaagctttcaacatcaaagttttgtctttgaaaccagtga |
1445205 |
T |
|
| Q |
298 |
ttttgctctgtcctgttctcagttaacattaatgnnnnnnnataaatatcactaaaagcatttttctctattaaaaatatcaaatgtatagatcttacaa |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445204 |
ttttgctctgtcctgttctcagttaacattaatgtttttttataaatatcactaaaagcatttttctctattaaaaatatcaaatgtatagatcttacaa |
1445105 |
T |
|
| Q |
398 |
acttgttgattatgtgcggtgcggtatataacatgaacttcaatttgccaaacaaaattcccttactttatggttaatttgattcaccaaatttaagata |
497 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445104 |
acttgttgattatgtgcggtgcggtatataacatgaacttcaatttgccaaacaaaattcccttactttatggttaatttgattcaccaaatttaagata |
1445005 |
T |
|
| Q |
498 |
tgactgcnnnnnnnnnnnnnatcatgaatatttaactattatgtctcaagaa |
549 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1445004 |
tgactgc--tttttttttttatcatgaatatttaactattatgtctcaagaa |
1444955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 148; E-Value: 8e-78
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 1445484 - 1445333
Alignment:
| Q |
18 |
cgattactgttaactgtgatgatatactgcactgaaaattacaggttttaaattgcaatttcgattactgttttgttgtgatatcgttgagtattacaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445484 |
cgattactgttaactgtgatgatatactgcactgaaaattacaggttttaaattgcaatttcaattactgttttgttgtgatatcgttgagtattacaat |
1445385 |
T |
|
| Q |
118 |
atagtatatggcttatgccttattattacaatatagtatgttgtcgtctaac |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1445384 |
atagtatatggcttatgccttattattacaatatagtatgttgtcgtctaac |
1445333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 436 - 500
Target Start/End: Complemental strand, 1453187 - 1453123
Alignment:
| Q |
436 |
ttcaatttgccaaacaaaattcccttactttatggttaatttgattcaccaaatttaagatatga |
500 |
Q |
| |
|
||||||||||||| | |||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1453187 |
ttcaatttgccaaccgaaattctcttactttatggttaatttgattcaccatatttaagatatga |
1453123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University