View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17760_high_9 (Length: 317)
Name: NF17760_high_9
Description: NF17760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17760_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 22 - 298
Target Start/End: Complemental strand, 20294874 - 20294598
Alignment:
| Q |
22 |
ttggcctacagtatgtaaggacattatcgacctcttcctctataatgcaacgacggaagatattgtctgcacctcacttgaaaaggaggggttcatccca |
121 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20294874 |
ttggcctacagtaggtaaggacactatcgacctcttcctctataatgcaacgacggaatatactgtctgcacctcacttgaaaaggaggggttcatccca |
20294775 |
T |
|
| Q |
122 |
gtaatattgttttagatcattgaagaactttttcttccgctgatagtccatgttaggaggaagaaccctagcggcaaggtagttgtcgaagtcagcatac |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20294774 |
gtaatattgctttagatcattgaagaactttttcttccgctgatagtccatgttaggaggcagaaccctagcggcaaggtagttgtcgaagtcagcatac |
20294675 |
T |
|
| Q |
222 |
caaggtgccacagacttcacggatgctatcagcctatcatcagggaaaaagtcatccaaaggtaactcatctcgctt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20294674 |
taaggtgccacagacttcacggatgctatcagcctatcatcagggaaaaagtcatccaaaggtaactcatctcgctt |
20294598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 36 - 288
Target Start/End: Original strand, 19808019 - 19808271
Alignment:
| Q |
36 |
gtaaggacattatcgacctcttcctctataatgcaacgacggaagatattgtctgcacctcacttgaaaaggaggggttcatcccagtaatattgtttta |
135 |
Q |
| |
|
||||||||| | ||||| ||||||||| ||||||||||||||||||| |||||| |||| ||||||||||||||| ||||||||||||||||| || | |
|
|
| T |
19808019 |
gtaaggacactctcgacttcttcctctggaatgcaacgacggaagataccgtctgcgcctcgcttgaaaaggaggggctcatcccagtaatattgcttaa |
19808118 |
T |
|
| Q |
136 |
gatcattgaagaactttttcttccgctgatagtccatgttaggaggaagaaccctagcggcaaggtagttgtcgaagtcagcataccaaggtgccacaga |
235 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||| || || |||| |||||||||||||||| | |||||||||||||| |||||||||| |
|
|
| T |
19808119 |
gatcattgaagaactttttcttccgttgatagtccatgtcagggggtaggaccccagcggcaaggtagttgacaaagtcagcataccagggtgccacagt |
19808218 |
T |
|
| Q |
236 |
cttcacggatgctatcagcctatcatcagggaaaaagtcatccaaaggtaact |
288 |
Q |
| |
|
||| ||||||||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
19808219 |
ctttacggatgctatcaacctatcatcagggaaagagtcatctaaaggtaact |
19808271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University