View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_high_22 (Length: 416)
Name: NF17761_high_22
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 367; Significance: 0; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 1 - 398
Target Start/End: Original strand, 32190765 - 32191171
Alignment:
| Q |
1 |
ggggaagagaagaagatttcaaccagcgagcttatggcgagtgcaaaaattgtagcagaggcagcacaatcaagtttggggaaaggctctgcagatcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190765 |
ggggaagagaagaagatttcaaccagcgagcttatggcgagtgcaaaaattgtagcagaggcagcacaatcaagtttggggaaaggctctgcagatcaaa |
32190864 |
T |
|
| Q |
101 |
agccgatggacaaggcgaaggtggcggaggctgcaggagatcttcttgatgcggttggtcagtatgctaaattggatgatcagaaggggttaggacagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190865 |
agccgatggacaaggcgaaggtggcggaggctgcaggagatcttcttgatgcggttggtcagtatgctaaattggatgatcagaaggggttaggacagta |
32190964 |
T |
|
| Q |
201 |
tgttgataaggctgctgattatctgcatggttatcatcccaaaggtcatgatgcggccacgacacctccaccttcttccaaaccggatcatcacaaaggt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190965 |
tgttgataaggctgctgattatctgcatggttatcatcccaaaggtcatgatgcggccacgactgctccaccttcttccaaaccggatcatcacaaaggt |
32191064 |
T |
|
| Q |
301 |
aatgatgcggaaaagtctga---------aggtggacatcatgggttaggtgatggtcttgctaaggttgctggaggcttctttaaatgataattcactg |
391 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191065 |
aatgatgcggaaaagtctgaaggtggaggaggtggacatcatgggttaggtgatggtcttgctaaggttgctggaggcttctttaaatgataattcactg |
32191164 |
T |
|
| Q |
392 |
atttcat |
398 |
Q |
| |
|
||||||| |
|
|
| T |
32191165 |
atttcat |
32191171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 130 - 228
Target Start/End: Original strand, 32210269 - 32210367
Alignment:
| Q |
130 |
gctgcaggagatcttcttgatgcggttggtcagtatgctaaattggatgatcagaaggggttaggacagtatgttgataaggctgctgattatctgcat |
228 |
Q |
| |
|
||||| || |||||||| ||||| |||||||||||||||||||||||||||||||| || ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32210269 |
gctgctggtgatcttctagatgcagttggtcagtatgctaaattggatgatcagaaaggtgtaggatcatatgttgataaagctgctgattatctgcat |
32210367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 4 - 85
Target Start/End: Original strand, 32210161 - 32210242
Alignment:
| Q |
4 |
gaagagaagaagatttcaaccagcgagcttatggcgagtgcaaaaattgtagcagaggcagcacaatcaagtttggggaaag |
85 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| |||||||| | ||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
32210161 |
gaagagaagaagatttcaaccagtgagctaatggcaagtgcaaaggtagtagcagaggcagcacagtcaggttttgggaaag |
32210242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University