View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_high_36 (Length: 349)
Name: NF17761_high_36
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_high_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 17 - 329
Target Start/End: Original strand, 42161966 - 42162278
Alignment:
| Q |
17 |
catagggttgtatttgatgaacgtgacgtggcacttcatggagagtttttaaaggaagtgaaggagttgttattaacggaggaagagttaggggttggtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161966 |
catagggttgtatttgatgaacgtgacgtggcacttcatggagagtttttaaaggaagtgaaggagttgttattaacggaggaagagttaggggttggtg |
42162065 |
T |
 |
| Q |
117 |
tggttttgccaagggtgtttgtgaagggtaggtatttgggtgggttggatgagttgatggagcttaatgaaacgggtcgacttgggaggatactgaatgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42162066 |
tggttttgccaagggtgtttgtgaagggtaggtatttgggtgggttggatgagttgatggagcttaatgaaacgggtcgacttgggaggatactgaatgc |
42162165 |
T |
 |
| Q |
217 |
gacacgtgtggagagaggtgttggaagacaagggtgtgttggatgtggtggggttagatttgttccttgttgggattgtggtgggagttgtaagttggtt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42162166 |
gacacgtgtggagagaggtgttggaagacaagggtgtgttggatgtggtggggttagatttgttccttgttgggattgtggtgggagttgtaagttggtt |
42162265 |
T |
 |
| Q |
317 |
gctgctgatgctg |
329 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
42162266 |
acttctgatgctg |
42162278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University