View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17761_high_40 (Length: 339)

Name: NF17761_high_40
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17761_high_40
NF17761_high_40
[»] chr8 (2 HSPs)
chr8 (10-119)||(25143404-25143513)
chr8 (183-243)||(25143280-25143340)
[»] chr7 (2 HSPs)
chr7 (10-119)||(31039502-31039611)
chr7 (183-244)||(31039377-31039438)
[»] chr2 (1 HSPs)
chr2 (185-244)||(28164531-28164590)
[»] chr3 (1 HSPs)
chr3 (183-243)||(27262367-27262427)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 10 - 119
Target Start/End: Complemental strand, 25143513 - 25143404
Alignment:
10 ttgacctttgcaccagtgtggttttaggaggttgtagcaacagctcgcgccggtgactcctagttattctcccggcggctggtttccatggatgtgctgg 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||| |||    
25143513 ttgacctttgcaccagtgtggttttaggaggttgtagcaacagctcgcgctggtgactcctagttattctcccgtcggctggttttcatggatgtgttgg 25143414  T
110 ttttcgtttc 119  Q
    ||||||||||    
25143413 ttttcgtttc 25143404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 183 - 243
Target Start/End: Complemental strand, 25143340 - 25143280
Alignment:
183 agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaag 243  Q
    |||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
25143340 agtttttagacccggatttggatctagatctagatccgttttgtggttgctgctgagaaag 25143280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 10 - 119
Target Start/End: Complemental strand, 31039611 - 31039502
Alignment:
10 ttgacctttgcaccagtgtggttttaggaggttgtagcaacagctcgcgccggtgactcctagttattctcccggcggctggtttccatggatgtgctgg 109  Q
    |||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||    
31039611 ttgacctttgtaccagtgtgattttaggaggttgtagcaacagctcgcaccggtgactcctagttattctcctggcggctggttttcatggatgtgctgg 31039512  T
110 ttttcgtttc 119  Q
    ||||||||||    
31039511 ttttcgtttc 31039502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 183 - 244
Target Start/End: Complemental strand, 31039438 - 31039377
Alignment:
183 agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaagc 244  Q
    |||||||||||||||||||||||||||||||||||  ||||||||||||||| |||||||||    
31039438 agtttttagacccggatttggatctagatctagatccgttttgtggttgctgttgagaaagc 31039377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 185 - 244
Target Start/End: Original strand, 28164531 - 28164590
Alignment:
185 tttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaagc 244  Q
    |||||||||||| ||||| ||||||||||||||  ||||||||||||||| |||||||||    
28164531 tttttagacccgaatttgaatctagatctagatccgttttgtggttgctgttgagaaagc 28164590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 183 - 243
Target Start/End: Complemental strand, 27262427 - 27262367
Alignment:
183 agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaag 243  Q
    ||||||||||  |||||||||||||||||||||||   ||||||| | | |||||||||||    
27262427 agtttttagattcggatttggatctagatctagatcccttttgtgatggttgctgagaaag 27262367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University