View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_high_57 (Length: 270)
Name: NF17761_high_57
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_high_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 32383634 - 32383875
Alignment:
| Q |
10 |
catcatcatcaatagaaccaacccataacctaagacaagcacaatcaacaaaagcaaatccatatgtaactgaaccattatccgagccattgctttcctg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32383634 |
catcatcatcaatagaaccaacccataacctaagacgagcacaatcaacaaaagcaaatccatatgtaactgaaccattatccgagccattgctttcctg |
32383733 |
T |
|
| Q |
110 |
aagaaaatatacaattcattgtcacatcaataattcaaagtattaacatttaacatcattatacatcacaaacacttatcatagcacacagaaaatgaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32383734 |
aagaaaatatacaattcattgtcacaacaataattcaaagtattaacatttaacatcattatacatcacaaacacttatcatagcacacagaaaatgaac |
32383833 |
T |
|
| Q |
210 |
aattcaacaacggtgagaagtgggaacctcttttattgcaag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32383834 |
aattcaacaacggtgagaagtgggaacctcttttattgcaag |
32383875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University