View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17761_high_64 (Length: 250)
Name: NF17761_high_64
Description: NF17761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17761_high_64 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 37017727 - 37017487
Alignment:
| Q |
10 |
aagaatatatatcaaatgattcattctatcgatgctagacttcttaatgccacaattcaagatgcgtaagtattaattaattctctaaacttgcttaaaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37017727 |
aagaaaatatatcaaatgattcattctatcgatgctagacttcttaatgccacaattcaagatgcgtaagtattaattaattctctaaacttgcttaaaa |
37017628 |
T |
|
| Q |
110 |
aatttatagcatttgattttacatatatgtatgtgttattgcagtcgtttttgcaagcctagaacacttgaccctaccaaagtaaagggaaagatattag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37017627 |
aatttatagcatttgattttacatatatgtatgtgttattgcagtcgtttttgcaagcctagaacacttgatcctaccaaagtaaagggaaagatattag |
37017528 |
T |
|
| Q |
210 |
tctgtactcgacttgagggaacaacgtccgttgctcaaggc |
250 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37017527 |
tttgtactcgacttgagggaacaacgtccgttgctcaaggc |
37017487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University